Puzzle 11
Sequence (5' to 3'):
GGGAUCUGUCACCCCAUUGAUCGCCUUCGGGCUGAUCUGGCUGG
CUAGGCGGGUCCC
Puzzle: 7SK
Crystal structure kindly provided by: Anne-Catherine Dock-Bregeon
Reference: Martinez-Zapien D, Legrand P, McEwen AG, Proux F, Cragnolini T, Pasquali S, Dock-Bregeon AC. The crystal structure of the 5΄ functional domain of the transcription riboregulator 7SK. Nucleic Acids Res. 2017 Apr 7;45(6):3568-3579. doi: 10.1093/nar/gkw1351. Bourbigot S, Dock-Bregeon AC, Eberling P, Coutant J, Kieffer B, Lebars I. Solution structure of the 5'-terminal hairpin of the 7SK small nuclear RNA. RNA. 2016 Dec;22(12):1844-1858. Epub 2016 Oct 20.