Skip to main content
logo RNA-Puzzles
  • News
  • Results
  • Open Puzzles
  • Groups
  • Publications
  • Resource
  • RSS RSS
  • RNA-Puzzles
  • Home
  • News
  • Results
  • Open Challenges
  • Community
  • Publications
  • Resouce
  • Github

Puzzle 31

Sequence (5' to 3'):

GGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGAA ACACUGAUGUCGUAUACAGGGCG

Puzzle: PFSE in Sars-CoV-2

Crystal structure kindly provided by: Joseph A Piccirilli

Reference: The SARS-CoV-2 Programmed -1 Ribosomal Frameshifting Element Crystal Structure Solved to 2.09 angstrom Using Chaperone-Assisted RNA Crystallography. ACS Chem Biol (2021) 16: 1469-1481

PDB id: 7mlx

raw prediction | Assessment results

Posted by Chichau Miao ordinal   results

  • « Puzzle 30
  • Puzzle 32 »

RNA-Puzzles

A CASP-like evaluation of RNA three-dimensional structure prediction

Recent Posts

PZ20 Release Unknown Rfam Puzzles First Round Prediction Release Unknown Rfam Puzzles First Round Closed New Domain Name New RNA-Puzzles Website at Github

GitHub Repos

Status updating...

@RNA-Puzzles on GitHub

Categories

group (4)
news (6)
results (34)
table (77)

Google+

Copyright © 2022 - Chichau Miao; The website is powered by Volcano Engine.