Skip to main content
logo RNA-Puzzles
  • News
  • Results
  • Open Puzzles
  • Groups
  • Publications
  • Resource
  • RSS RSS
  • RNA-Puzzles
  • Home
  • News
  • Results
  • Open Challenges
  • Community
  • Publications
  • Resouce
  • Github

Puzzle 33

Sequence (5' to 3'):

GGAGUAGAAGCGUUCAGCGGCCGAAAGGCCGCCCGGAAAUUGCUCC

Puzzle: xanthine riboswitch (Ideonella sp. B508-1)

Crystal structure kindly provided by: Aiming Ren

Reference: Insights into xanthine riboswitch structure and metal ion-mediated ligand recognition. Nucleic Acids Res (2021)

PDB id: 7elp 7elq 7elr 7els

raw prediction | Assessment results

Posted by Chichau Miao ordinal   results

  • « Puzzle 32
  • Puzzle 34 »

RNA-Puzzles

A CASP-like evaluation of RNA three-dimensional structure prediction

Recent Posts

PZ20 Release Unknown Rfam Puzzles First Round Prediction Release Unknown Rfam Puzzles First Round Closed New Domain Name New RNA-Puzzles Website at Github

GitHub Repos

Status updating...

@RNA-Puzzles on GitHub

Categories

group (4)
news (6)
results (34)
table (77)

Google+

Copyright © 2022 - Chichau Miao; The website is powered by Volcano Engine.